BDGP Resources

Large Inserts: PCR Amplification of DGC cDNAs greater than 3.5kb

---

Michelle Chew, BDGP, Lawrence Berkeley National Labs

Reagents for one 14uL Rxn:

        10X Advantage Buffer    1.4uL
        10 mM dNTPs             0.3uL
        20uM PM001a             0.225uL
        20uM PM002a             0.225uL
        Template                3.0uL from 3:150 dilution in H2O from
                                Original bacterial cDNA frozen stock plate
        Advantage Taq (5U/uL)*  0.15uL
        ddH2O                   8.7uL

PCR profile:

        95C             1 min
        95C             0.5min                  
        73C-->63C*      0.75min              Touchdown for 5 cycles
        68C             3 min +0.2min        [the annealing temp. was decreased by 2C for
                                             5 cycles]
        95C             1 min                   
        63C             0.75min             Auto extend for 28 cycles**
        68C             4 min + 0.1min  

        68C             15 min
        4C              soak

PM001a Primer
5'- GTCGACGTTAGAACGCGGCTAC - 3'

PM002a Primer
5'- GGGTTAAATTCCCGGGTACTGC - 3'

Advantage cDNA Polymerase Mix (50x) (#8417-1) Available from CLONTECH Laboratories, Inc.

We have also successfully used DyNAzyme EXT DNA Polymerase (1U/uL) (F-505S) with EXT Buffer (F-514) made by Finnzymes and available from MJ Research, Inc. (1-888-662-2566)

We used the same amount of DyNAzyme per reaction (0.15uL) despite the lower unit concentration to size our cDNAs and it works fine. Although for longer PCR products, you might consider raising the volume of DyNAzyme used per reaction.

*The annealing temperatures were determined using nearest neighbor method. We did notice that sometimes we saw spurious bands so the annealing temperature was raised to 66C to help get rid of unwanted short products.

**You may also want to increase the number of cycles to 35 if you still cannot PCR the longest cDNAs. rev. 8.23.00